Maybe it was used in order to show that the PCR actually worked – that is, you had intact DNA and the conditions in your machine were conducive to replication.

If you didn’t use a ladder in the gel, then the insulin bands could be used as molecular weight markers.

Ovalbumin is a protease inhibitor (prevents catabolism or breakdown of proteins), while insulin regulates anabolism, and consequently carbohydrate breakdown. So they kind of regulate opposite reactions. . .

Did you extract the DNA yourself? Maybe you had to use both in order to show that your extraction methods were reliable.

Did you manipulate the organism/sample/cell before you extracted DNA? Maybe there’s a pathway that would involve both insulin and ovalbumin, where insulin came first, and you needed to show that the lack of insulin was not a factor in the lack/presence of ovalbumin.

The solutions interior the e book are the main suitable option because of the fact: The sequence given interior the question is DNA interior the 5’-3’ direction, i.e. 5’-ATAGGCATAGGCCCATATGGCATA-3’….. DNA polymerase can purely synthesise 5’to 3’ DNA strands, for this reason it sits on the template strand and purely strikes in a three’ to 5’ direction. So in case you think of the DNA polymerase sitting on the above strand it is going to circulate from proper (3’) to left (5’) synthesising a 5’ to 3’ strand. for this reason it is going to synthesise the complementary sequence from the above template from proper to left i.e. 5’-TATGCC…..-3’ etc. despite if because of the fact the DNA is double stranded you in addition to would could evaluate the complementary strand it is present i.e. 3′ – TATCCGTATCCGGGTATACCGTATTCCGAA…. – 5′ back in case you think of the DNA polymerase sitting in this template strand it is going to synthesise a 5’ to 3’ strand via shifting in a three’ to 5’ direction on the template strand. This time shifting left (3′) to proper (5′). i.e. will make: 5’-ATAGGCA-3’ etc.